pCGLex
(Plasmid
#17264)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPC86
- Backbone size (bp) 6160
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- LexA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer CGTCAGCAGAGCTTCACCATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ref for pPC86: Chevray, P. M. & Nathans, D. (1992) Proc. Natl. Acad. Sci. USA 89, 5789-5793; ref for pEG202: Golemis, E. A., Gyuris, J. & Brent, R. (1996) in Current Protocols in Molecular Biology, eds. Ausubel, F. M., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J. A. & Struhl, K. (Wiley, New York), p. 20.1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCGLex was a gift from Stuart Schreiber (Addgene plasmid # 17264 ; http://n2t.net/addgene:17264 ; RRID:Addgene_17264) -
For your References section:
A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang J, Schreiber SL. Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. 10.1073/pnas.94.25.13396 PubMed 9391035
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/24/74/20d0c83e-af62-11e0-90fe-003048dd6500.jpeg.940x940_q85_autocrop.png)