Skip to main content
Addgene

pTRIPZ-TIR1-HA
(Plasmid #172610)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172610 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTRIPZ
  • Backbone manufacturer
    Horizon Discovery
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TIR1
  • Alt name
    Transport Inhibitor Response 1
  • Alt name
    osTIR1
  • Species
    Oryza sativa
  • Promoter Tet/ON Minimal CMV promoter
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GAACGTATGTCGAGGTAGGCG
  • 3′ sequencing primer T7
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

osTIR1 encodes the substrate receptor (Fbox protein) of a plant SCF E3 ubiquitin ligase complex known to mediate the ubiquitylation/degradation of substrates containing the auxin-inducible degron (AID) in the presence of the plant hormone auxin (indole-30-acetic acid)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ-TIR1-HA was a gift from Michele Pagano (Addgene plasmid # 172610 ; http://n2t.net/addgene:172610 ; RRID:Addgene_172610)

  • For your References section:

    CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235
Related items:
Commonly requested with: