px458-AMBRA1 (optimized for N-terminal knock-in)
(Plasmid
#172608)
-
PurposeExpresses a gRNA against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFP. This gRNA is suitable for the N-terminal knock-in of AMBRA1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx458
-
Backbone manufacturerF. Zhang (Addgene plasmid #48138)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA against AMBRA1
-
gRNA/shRNA sequenceGTGGCTACTGAGCGCCATGA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneAMBRA1 (a.k.a. DCAF3, WDR94)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For the N-terminal knock-in of AMBRA1 with a 2xFLAG-mAID tag, please use this gRNA in combination with pUC57-2xFLAG-mAID-AMBRA1 HDR donor template
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px458-AMBRA1 (optimized for N-terminal knock-in) was a gift from Michele Pagano (Addgene plasmid # 172608 ; http://n2t.net/addgene:172608 ; RRID:Addgene_172608) -
For your References section:
CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235