pLenti6.3delta4 GPR3-V5
(Plasmid
#172601)
-
PurposeLentiviral plasmid expressing c-terminal V5-tagged GPR3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti6.3V5DEST
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 9387
- Total vector size (bp) 10380
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameG protein-Coupled Receptor 3
-
Alt nameGPR3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)993
-
MutationWT
-
GenBank IDNM_005281.4
-
Entrez GeneGPR3 (a.k.a. ACCA)
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti6.3delta4 GPR3-V5 was a gift from Robert Screaton (Addgene plasmid # 172601 ; http://n2t.net/addgene:172601 ; RRID:Addgene_172601) -
For your References section:
Silencing the G-protein coupled receptor 3-salt inducible kinase 2 pathway promotes human beta cell proliferation. Iorio C, Rourke JL, Wells L, Sakamaki JI, Moon E, Hu Q, Kin T, Screaton RA. Commun Biol. 2021 Jul 23;4(1):907. doi: 10.1038/s42003-021-02433-2. 10.1038/s42003-021-02433-2 PubMed 34302056