Skip to main content
Addgene

pGMC00014
(Plasmid #172526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172526 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiCRISPRv2-mCherry
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non-targeting guide
  • gRNA/shRNA sequence
    GTGTCGTGATGCGTAGACGG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00014 was a gift from Raj Chari (Addgene plasmid # 172526 ; http://n2t.net/addgene:172526 ; RRID:Addgene_172526)
  • For your References section:

    Activating Mucosal-Associated Invariant T Cells Induces a Broad Antitumor Response. Ruf B, Catania VV, Wabitsch S, Ma C, Diggs LP, Zhang Q, Heinrich B, Subramanyam V, Cui LL, Pouzolles M, Evans CN, Chari R, Sakai S, Oh S, Barry CE III, Barber DL, Greten TF. Cancer Immunol Res. 2021 Jun 30. pii: 2326-6066.CIR-20-0925. doi: 10.1158/2326-6066.CIR-20-0925. 10.1158/2326-6066.CIR-20-0925 PubMed 34193462