pGMC00013
(Plasmid
#172525)
-
PurposesgRNA against mouse Mr1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiCRISPRv2-mCherry
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMr1
-
gRNA/shRNA sequenceACACTGTCGTATGTAGTGAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneMr1 (a.k.a. H2ls)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00013 was a gift from Raj Chari (Addgene plasmid # 172525 ; http://n2t.net/addgene:172525 ; RRID:Addgene_172525) -
For your References section:
Activating Mucosal-Associated Invariant T Cells Induces a Broad Antitumor Response. Ruf B, Catania VV, Wabitsch S, Ma C, Diggs LP, Zhang Q, Heinrich B, Subramanyam V, Cui LL, Pouzolles M, Evans CN, Chari R, Sakai S, Oh S, Barry CE III, Barber DL, Greten TF. Cancer Immunol Res. 2021 Jun 30. pii: 2326-6066.CIR-20-0925. doi: 10.1158/2326-6066.CIR-20-0925. 10.1158/2326-6066.CIR-20-0925 PubMed 34193462