pgRNA-backbone
(Plasmid #172517)

• Purpose: Yeast plasmid encoding a 2-kb gRNA-placeholder flanked by BsmBI/Esp3I restriction sites to facilitate gRNA insertion
• Depositing Lab: Leonid Kruglyak
• Publication: Schubert et al Elife. 2022 Nov 3;11. pii: 79525. doi: 10.7554/eLife.79525.

Backbone

• Vector backbone: p426
• Backbone manufacturer: Mumberg et al. (Nucleic Acids Research, 1994, Vol. 22, No. 25)
• Backbone size w/o insert (bp): 6145
• Total vector size (bp): 8104
• Modifications to backbone: Removed 3 BsmBI/Esp3I restrictions sites
• Vector type: Yeast Expression, CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA cassette
• Species: Synthetic
• Insert Size (bp): 1959
• Promoter: SNR52

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTAACCCTCACTAAAG
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pgRNA-backbone-pOS05a.gb
• A portion of this plasmid was derived from a plasmid made by: Insert (gRNA cassette) from lentiCRISPR v2 (Addgene #52961); backbone from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene #43803)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry