Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

U6-sgR26-eCas9-T2A-BlastR
(Plasmid #172493)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172493 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lentivirus
  • Vector type
    Mouse Targeting, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eCas9, BlastR and sgRNA targeting the Rosa26 (R26) safe harbor locus
  • gRNA/shRNA sequence
    GGATTCTCCCAGGCCCAGGG
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6-sgR26-eCas9-T2A-BlastR was a gift from Tyler Jacks (Addgene plasmid # 172493 ; http://n2t.net/addgene:172493 ; RRID:Addgene_172493)
  • For your References section:

    The CD155/TIGIT axis promotes and maintains immune evasion in neoantigen-expressing pancreatic cancer. Freed-Pastor WA, Lambert LJ, Ely ZA, Pattada NB, Bhutkar A, Eng G, Mercer KL, Garcia AP, Lin L, Rideout WM 3rd, Hwang WL, Schenkel JM, Jaeger AM, Bronson RT, Westcott PMK, Hether TD, Divakar P, Reeves JW, Deshpande V, Delorey T, Phillips D, Yilmaz OH, Regev A, Jacks T. Cancer Cell. 2021 Oct 11;39(10):1342-1360.e14. doi: 10.1016/j.ccell.2021.07.007. Epub 2021 Aug 5. 10.1016/j.ccell.2021.07.007 PubMed 34358448