U6-sgR26-eCas9-T2A-BlastR
(Plasmid
#172493)
-
PurposeFor CRISPR-assisted HDR, Rosa26 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentivirus
-
Vector typeMouse Targeting, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeCas9, BlastR and sgRNA targeting the Rosa26 (R26) safe harbor locus
-
gRNA/shRNA sequenceGGATTCTCCCAGGCCCAGGG
-
SpeciesM. musculus (mouse)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-sgR26-eCas9-T2A-BlastR was a gift from Tyler Jacks (Addgene plasmid # 172493 ; http://n2t.net/addgene:172493 ; RRID:Addgene_172493) -
For your References section:
The CD155/TIGIT axis promotes and maintains immune evasion in neoantigen-expressing pancreatic cancer. Freed-Pastor WA, Lambert LJ, Ely ZA, Pattada NB, Bhutkar A, Eng G, Mercer KL, Garcia AP, Lin L, Rideout WM 3rd, Hwang WL, Schenkel JM, Jaeger AM, Bronson RT, Westcott PMK, Hether TD, Divakar P, Reeves JW, Deshpande V, Delorey T, Phillips D, Yilmaz OH, Regev A, Jacks T. Cancer Cell. 2021 Oct 11;39(10):1342-1360.e14. doi: 10.1016/j.ccell.2021.07.007. Epub 2021 Aug 5. 10.1016/j.ccell.2021.07.007 PubMed 34358448