pMXs-IP-mVenus-TOSI
(Plasmid #172491)

• Purpose: mVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.
• Depositing Lab: David Scadden
• Publication: Oki et al Nat Commun. 2021 Jan 11;12(1):245. doi: 10.1038/s41467-020-20491-8.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Toshi Kitamura at University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6800
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pdcd4
• Species: M. musculus (mouse)
• Insert Size (bp): 240
• Entrez Gene: Pdcd4 (a.k.a. D19Ucl, D19Ucla1, MA-, Ma3, T, Tis)
• Promoter: MLV LTR
• Tag / Fusion Protein:
  • mVenus (N terminal on insert)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: CCACCGCCCTCAAAGTAGACG
• 3′ sequencing primer: NA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry