pET28a_His-TEV-EiCsm6
(Plasmid
#172487)
-
PurposeBacterial expression of codon-optimized His-EiCsm6 with a TEV protease cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
- Total vector size (bp) 6604
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEnterococcus italicus Csm6 (codon optimized)
-
Alt nameEiCsm6
-
Alt namecsm6
-
SpeciesSynthetic
- Promoter T7 promoter and lac operator
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genscript synthesized the EiCsm6 gene fragment and cloned it into the pET28a vector.
Please visit https://www.medrxiv.org/content/10.1101/2021.03.19.21253328v1 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a_His-TEV-EiCsm6 was a gift from Jennifer Doudna (Addgene plasmid # 172487 ; http://n2t.net/addgene:172487 ; RRID:Addgene_172487) -
For your References section:
Accelerated RNA detection using tandem CRISPR nucleases. Liu TY, Knott GJ, Smock DCJ, Desmarais JJ, Son S, Bhuiya A, Jakhanwal S, Prywes N, Agrawal S, Diaz de Leon Derby M, Switz NA, Armstrong M, Harris AR, Charles EJ, Thornton BW, Fozouni P, Shu J, Stephens SI, Kumar GR, Zhao C, Mok A, Iavarone AT, Escajeda AM, McIntosh R, Kim S, Dugan EJ, Pollard KS, Tan MX, Ott M, Fletcher DA, Lareau LF, Hsu PD, Savage DF, Doudna JA. Nat Chem Biol. 2021 Sep;17(9):982-988. doi: 10.1038/s41589-021-00842-2. Epub 2021 Aug 5. 10.1038/s41589-021-00842-2 PubMed 34354262