Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SWEET11:SWEET11-2A-GFP-GUS
(Plasmid #172484)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172484 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKGWFS7,0
  • Backbone size w/o insert (bp) 19010
  • Total vector size (bp) 23912
  • Vector type
    Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SWEET11
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    4902
  • Promoter SWEET11
  • Tag / Fusion Protein
    • GFP, GUS (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ttttgtacgtaacttctatcgatgc
  • 3′ sequencing primer CAGCTCCTCGCCCTTGCTCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains I60F, Q279E, and V420-P426 mutations in GUS. These mutations are not known to affect plasmid function as the plasmid was functional for depositor's experiments.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SWEET11:SWEET11-2A-GFP-GUS was a gift from Wolf Frommer (Addgene plasmid # 172484 ; http://n2t.net/addgene:172484 ; RRID:Addgene_172484)
  • For your References section:

    Distinct identities of leaf phloem cells revealed by single cell transcriptomics. Kim JY, Symeonidi E, Pang TY, Denyer T, Weidauer D, Bezrutczyk M, Miras M, Zollner N, Hartwig T, Wudick MM, Lercher M, Chen LQ, Timmermans MCP, Frommer WB. Plant Cell. 2021 May 5;33(3):511-530. doi: 10.1093/plcell/koaa060. 10.1093/plcell/koaa060 PubMed 33955487