SWEET11:SWEET11-2A-GFP-GUS
(Plasmid
#172484)
-
PurposeTranslational fusion of SWEET11 with a P2A self cleaving peptide sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKGWFS7,0
- Backbone size w/o insert (bp) 19010
- Total vector size (bp) 23912
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSWEET11
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)4902
- Promoter SWEET11
-
Tag
/ Fusion Protein
- GFP, GUS (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ttttgtacgtaacttctatcgatgc
- 3′ sequencing primer CAGCTCCTCGCCCTTGCTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains I60F, Q279E, and V420-P426 mutations in GUS. These mutations are not known to affect plasmid function as the plasmid was functional for depositor's experiments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SWEET11:SWEET11-2A-GFP-GUS was a gift from Wolf Frommer (Addgene plasmid # 172484 ; http://n2t.net/addgene:172484 ; RRID:Addgene_172484) -
For your References section:
Distinct identities of leaf phloem cells revealed by single cell transcriptomics. Kim JY, Symeonidi E, Pang TY, Denyer T, Weidauer D, Bezrutczyk M, Miras M, Zollner N, Hartwig T, Wudick MM, Lercher M, Chen LQ, Timmermans MCP, Frommer WB. Plant Cell. 2021 May 5;33(3):511-530. doi: 10.1093/plcell/koaa060. 10.1093/plcell/koaa060 PubMed 33955487