pLV_iRFP_P2AT2A_mScarlet-I_Myl9
(Plasmid #172474)

• Purpose: Mammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.
• Depositing Lab: Sean R Collins
• Publication: Hadjitheodorou et al Nat Commun. 2021 Nov 16;12(1):6619. doi: 10.1038/s41467-021-26622-z.

Backbone

• Vector backbone: pLenti 2nd gen
• Backbone size w/o insert (bp): 9227
• Total vector size (bp): 11550
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: iRFP670
• Alt name: iRFP
• Species: Synthetic
• Insert Size (bp): 933
• GenBank ID:
• Promoter: EF1alpha (with UCOE)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggagtacgtcgtctttaggt
• 3′ sequencing primer: aggaccgggattttcttcc

Gene/Insert 2

• Gene/Insert name: mScarlet-I-Myl9
• Alt name: MYL9
• Alt name: myosin light chain
• Species: H. sapiens (human)
• Insert Size (bp): 1221
• GenBank ID: NM_006097
• Entrez Gene: MYL9 (a.k.a. LC20, MLC-2C, MLC2, MMIHS4, MRLC1, MYRL2)
• Promoter: none (same transcript as insert 1, separated by P2A-T2A element)
• Tag / Fusion Protein:
  • mScarlet-I (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGGGCAGAGGAAGTCTGC
• 3′ sequencing primer: cgtcttttggcaatgtgagg

Resource Information

• Supplemental Documents:
  • pLV_iRFP_P2AT2A_mScarlet-I_Myl9.gbk
• A portion of this plasmid was derived from a plasmid made by: MYL9 was a gift from Arnold Hayer. The iRFP670 was created by Vladislav Verkhusha's lab (Addgene #45466). The UCOE sequence was a gift from Jonathan Weissman's lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry