pPB_Cdc42-TomKat-sensor-CAAX
(Plasmid #172473)

• Purpose: Piggybac vector for mammalian expression of TomKat (tdTomato-tdKatushka) FRET sensor for Cdc42 activity anchored to the membrane with the polybasic and CAAX motif from Kras.
• Depositing Lab: Sean R Collins
• Publication: Bell et al Nat Commun. 2021 Nov 16;12(1):6148. doi: 10.1038/s41467-021-26371-z.

Backbone

• Vector backbone: pPB
• Backbone size w/o insert (bp): 6785
• Total vector size (bp): 10943
• Vector type: Mammalian Expression ; Piggybac transposon
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdKatushka2-PBD(Pak1)-EVlinker-Cdc42-tdTomato-CAAX
• Alt name: Cdc42 TomKat sensor
• Species: Synthetic
• Insert Size (bp): 4158
• Promoter: CAG
• Tags / Fusion Proteins:
  • polybasic and CAAX motif from Kras (C terminal on insert)
  • tdTomato
  • tdKatushka2

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cttctggcgtgtgaccg
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• Supplemental Documents:
  • pPB_Cdc42-TomKat-sensor-CAAX.gbk
• A portion of this plasmid was derived from a plasmid made by: This sensor is a modified version of a sensor originally developed by Michiyuki Matsuda's lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This sensor is based on the design of the Matsuda lab (https://www.ncbi.nlm.nih.gov/pubmed/21976697) but modified to use tdTomato as the FRET donor and tdKatushka as the FRET acceptor. The tdKatushka2 was originally cloned by Michael Davidson's lab (Addgene plasmid #56049).