Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACE-GIRK2-mC-S
(Plasmid #172428)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACEBac1
  • Backbone manufacturer
    Geneva Biotech
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GIRK2
  • Species
    H. sapiens (human)
  • Entrez Gene
    KCNJ6 (a.k.a. BIR1, GIRK-2, GIRK2, KATP-2, KATP2, KCNJ7, KIR3.2, KPLBS, hiGIRK2)
  • Tag / Fusion Protein
    • mCherry Streptag II (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatcatggagataattaaaatgataaccatctcgc
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACE-GIRK2-mC-S was a gift from Arthur Laganowsky (Addgene plasmid # 172428 ; http://n2t.net/addgene:172428 ; RRID:Addgene_172428)
  • For your References section:

    Insight into the Phospholipid-Binding Preferences of Kir3.4. Qiao P, Schrecke S, Lyu J, Zhu Y, Zhang T, Benavides A, Laganowsky A. Biochemistry. 2021 Dec 21;60(50):3813-3821. doi: 10.1021/acs.biochem.1c00615. Epub 2021 Nov 30. 10.1021/acs.biochem.1c00615 PubMed 34846128