pACE-GIRK2-mC-S
(Plasmid
#172428)
-
PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag II
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepACEBac1
-
Backbone manufacturerGeneva Biotech
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGIRK2
-
SpeciesH. sapiens (human)
-
Entrez GeneKCNJ6 (a.k.a. BIR1, GIRK-2, GIRK2, KATP-2, KATP2, KCNJ7, KIR3.2, KPLBS, hiGIRK2)
-
Tag
/ Fusion Protein
- mCherry Streptag II (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcatggagataattaaaatgataaccatctcgc
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACE-GIRK2-mC-S was a gift from Arthur Laganowsky (Addgene plasmid # 172428 ; http://n2t.net/addgene:172428 ; RRID:Addgene_172428) -
For your References section:
Insight into the Phospholipid-Binding Preferences of Kir3.4. Qiao P, Schrecke S, Lyu J, Zhu Y, Zhang T, Benavides A, Laganowsky A. Biochemistry. 2021 Dec 21;60(50):3813-3821. doi: 10.1021/acs.biochem.1c00615. Epub 2021 Nov 30. 10.1021/acs.biochem.1c00615 PubMed 34846128