pGal-BE3
(Plasmid #172409)

• Purpose: Yeast plasmid encoding the third-generation CRISPR base editor BE3 (Komor et al., Nature 2016) under a galactose-inducible promoter
• Depositing Lab: Leonid Kruglyak
• Publication: Schubert et al Elife. 2022 Nov 3;11. pii: 79525. doi: 10.7554/eLife.79525.

Backbone

• Vector backbone: p415-GALL
• Backbone manufacturer: Mumberg et al. (Nucleic Acids Research, 1994, Vol. 22, No. 25)
• Backbone size w/o insert (bp): 6653
• Total vector size (bp): 11786
• Vector type: Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BE3
• Alt name: Third generation CRISPR base editor
• Species: Synthetic
• Insert Size (bp): 5133
• Promoter: GALL

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTAACCCTCACTAAAG
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pGal-BE3-pOS02.gb
• A portion of this plasmid was derived from a plasmid made by: Insert (BE3) from pCMV-BE3 (Addgene #73021); backbone (p415-GALL) from p415-GalL-Cas9-CYC1t (Addgene #43804)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry