pM423
(Plasmid
#172408)
-
PurposeExpresses sfGFP (1-10) and MCP-GFP11
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE-DEST
- Backbone size w/o insert (bp) 6450
- Total vector size (bp) 8868
-
Modifications to backboneTetO deletion
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP, bipartite sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)392
- Promoter hPGK
-
Tag
/ Fusion Protein
- sfGFP {1-10} (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cctcgttgaccgaatcaccg
- 3′ sequencing primer agttaagaataccagtcaatctttcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Soluble bipartite sfGFP system expressing MCP-GFP11 and GFP1-10.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM423 was a gift from Hajin Kim (Addgene plasmid # 172408 ; http://n2t.net/addgene:172408 ; RRID:Addgene_172408) -
For your References section:
Background-suppressed live visualization of genomic loci with an improved CRISPR system based on a split fluorophore. Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H. Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4. 10.1101/gr.260018.119 PubMed 32887690