Skip to main content
Addgene

pM423
(Plasmid #172408)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172408 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6450
  • Total vector size (bp) 8868
  • Modifications to backbone
    TetO deletion
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCP, bipartite sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    392
  • Promoter hPGK
  • Tag / Fusion Protein
    • sfGFP {1-10} (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cctcgttgaccgaatcaccg
  • 3′ sequencing primer agttaagaataccagtcaatctttcac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Soluble bipartite sfGFP system expressing MCP-GFP11 and GFP1-10.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM423 was a gift from Hajin Kim (Addgene plasmid # 172408 ; http://n2t.net/addgene:172408 ; RRID:Addgene_172408)

  • For your References section:

    Background-suppressed live visualization of genomic loci with an improved CRISPR system based on a split fluorophore. Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H. Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4. 10.1101/gr.260018.119 PubMed 32887690
Related items:
Commonly requested with: