RUSH reporter-HMGB1-SBP-GFP
(Plasmid
#172357)
-
PurposeMonitoring of HMGB1 subcellular localization by fluorescence videomicroscopy
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDH-CMV-MCS-EF1-puro
-
Backbone manufacturersystem biosciences
- Backbone size w/o insert (bp) 7367
- Total vector size (bp) 8898
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehigh mobility group box 1
-
Alt nameHMGB1
-
SpeciesH. sapiens (human)
-
GenBank IDNM.002128.4
-
Entrez GeneHMGB1 (a.k.a. HMG-1, HMG1, HMG3, SBP-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- SBP-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RUSH reporter-HMGB1-SBP-GFP was a gift from Guido Kroemer (Addgene plasmid # 172357 ; http://n2t.net/addgene:172357 ; RRID:Addgene_172357) -
For your References section:
Identification of pharmacological agents that induce HMGB1 release. Liu P, Zhao L, Loos F, Iribarren K, Lachkar S, Zhou H, Gomes-da-Silva LC, Chen G, Bezu L, Boncompain G, Perez F, Zitvogel L, Kepp O, Kroemer G. Sci Rep. 2017 Nov 2;7(1):14915. doi: 10.1038/s41598-017-14848-1. 10.1038/s41598-017-14848-1 PubMed 29097772