pBAD-Padron2
(Plasmid
#172355)
-
PurposeExpresses the reversibly switchable fluorescent protein Padron2 in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBad
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 4091
- Total vector size (bp) 4808
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePadron2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDMZ404620.1
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6xHisTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-Padron2 was a gift from Stefan Jakobs (Addgene plasmid # 172355 ; http://n2t.net/addgene:172355 ; RRID:Addgene_172355) -
For your References section:
The Positive Switching Fluorescent Protein Padron2 Enables Live-Cell Reversible Saturable Optical Linear Fluorescence Transitions (RESOLFT) Nanoscopy without Sequential Illumination Steps. Konen T, Stumpf D, Grotjohann T, Jansen I, Bossi M, Weber M, Jensen N, Hell SW, Jakobs S. ACS Nano. 2021 May 21. doi: 10.1021/acsnano.0c08207. 10.1021/acsnano.0c08207 PubMed 34019380