pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
(Plasmid
#172317)
-
PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEG302
- Backbone size w/o insert (bp) 15826
- Total vector size (bp) 21241
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
-
Alt namedMQ1
-
SpeciesMollicutes Spiroplasma
-
Insert Size (bp)13669
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ATTTCTATCTAGATCTGGTGTT
- 3′ sequencing primer TAAGGATCTGAGCTACACATGCTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18 was a gift from Steven Jacobsen (Addgene plasmid # 172317 ; http://n2t.net/addgene:172317 ; RRID:Addgene_172317) -
For your References section:
CRISPR-based targeting of DNA methylation in Arabidopsis thaliana by a bacterial CG-specific DNA methyltransferase. Ghoshal B, Picard CL, Vong B, Feng S, Jacobsen SE. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23):e2125016118. doi: 10.1073/pnas.2125016118. 10.1073/pnas.2125016118 PubMed 34074795