pAAV-Sst22-GFP
(Plasmid #172312)

• Purpose: SST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneurons
• Depositing Lab: Michael Greenberg
• Publication: Hrvatin et al Elife. 2019 Sep 23;8. pii: 48089. doi: 10.7554/eLife.48089.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-mDlx-GFP-Fishell-1
• Backbone manufacturer: Addgene # 83900
• Backbone size w/o insert (bp): 4954
• Total vector size (bp): 5674
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sst22
• Alt name: GRE22
• Species: M. musculus (mouse)
• Insert Size (bp): 720
• Promoter: pB-Globin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: tcactaggggttcctgcgg
• 3′ sequencing primer: tgggcataaaagtcagggcaga

Resource Information

• Supplemental Documents:
  • paav-sst22-gfp (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry