Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Sst12-GFP
(Plasmid #172311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172311 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-mDlx-GFP-Fishell-1
  • Backbone manufacturer
    Addgene # 83900
  • Backbone size w/o insert (bp) 4954
  • Total vector size (bp) 5700
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sst12
  • Alt name
    GRE12
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    746
  • Promoter pB-Globin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer tcactaggggttcctgcgg
  • 3′ sequencing primer tgggcataaaagtcagggcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Sst12-GFP was a gift from Michael Greenberg (Addgene plasmid # 172311 ; http://n2t.net/addgene:172311 ; RRID:Addgene_172311)
  • For your References section:

    A scalable platform for the development of cell-type-specific viral drivers. Hrvatin S, Tzeng CP, Nagy MA, Stroud H, Koutsioumpa C, Wilcox OF, Assad EG, Green J, Harvey CD, Griffith EC, Greenberg ME. Elife. 2019 Sep 23;8. pii: 48089. doi: 10.7554/eLife.48089. 10.7554/eLife.48089 PubMed 31545165