2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_bKO
(Plasmid #172224)

• Purpose: Cas9-2A-GFP expression vector bearing two sgRNAs targeting the telomeric human NANOG CTCF-boundary.
• Depositing Lab: Alexander Meissner
• Publication: Wu et al Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7.

Backbone

• Vector backbone: 2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
• Backbone manufacturer: Alexander Meissner
• Backbone size w/o insert (bp): 9699
• Total vector size (bp): 9703
• Modifications to backbone: Two sgRNAs targeting the telomeric human NANOG CTCF-boundary are cloned into the BbsI (not restored) and SapI (not restored) site.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA
• gRNA/shRNA sequence: CATCCTTTGATACACCCCCT, TGTTAGTCTTTGTTCAACCG
• Species: H. sapiens (human)
• GenBank ID: hg19, chr12:7958377-7958396 hg19, chr12:7960486-7960505
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n.a.
• 3′ sequencing primer: ggaaagtccctattggcgtta

Resource Information

• Supplemental Documents:
  • 2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_boundary_KO.gb
• A portion of this plasmid was derived from a plasmid made by: sgRNAs were ordered from Sigma-Aldrich as synthetic ssODN oligonucleotides.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry