2X_pX458_pSpCas9(BB)-2A-GFP
(Plasmid #172221)

• Purpose: (Empty Backbone) Cas9-2A-GFP expression vector bearing two (one additional) independent sgRNA cassettes.
• Depositing Lab: Alexander Meissner
• Publication: Wu et al Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7.

Backbone

• Vector backbone: pSpCas9(BB)-2A-GFP (Plasmid #48138)
• Backbone manufacturer: Feng Zhang
• Backbone size (bp): 9288
• Modifications to backbone: A second sgRNA cloning cassette (SapI clonable sgRNA) was inserted into the KpnI site (restored).
• Vector type: Mammalian Expression, CRISPR
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • GFP (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 3′ sequencing primer: ggaaagtccctattggcgtta

Resource Information

• Supplemental Documents:
  • 2X_pX458_pSpCas9(BB)-2A-GFP.gb
• A portion of this plasmid was derived from a plasmid made by: The inserted SapI sgRNA cassette was ordered as a dsDNA gBlock from IDT.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry