phCMV-coGALVenv-C4070A
(Plasmid #172217)

• Purpose: Expresses the envelope protein of Gibbon Ape Leukemia Virus (GALV) for pseudotyping of retroviral or lentiviral vectors
• Depositing Lab: Boris Fehse
• Publication: Mirow et al Viruses. 2021 Jul 27;13(8). pii: v13081471. doi: 10.3390/v13081471.

Backbone

• Vector backbone: phCMV
• Backbone size w/o insert (bp): 4816
• Total vector size (bp): 6892
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Any strain, nothing special needed.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Envelope protein of Gibbon Ape Leukemia Virus (codon-optimized version)
• Alt name: coGALVenv
• Alt name: Codon optimized for optimal expression in human packaging cells
• Species: Gibbon Ape Leukemia Virus
• Insert Size (bp): 2076
• Mutation: Carries C-terminus of amphotropic MLV strain 4070A to increase packaging efficiency
• Promoter: CMV immediate early promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TCCTACAGCTCCTGGGCAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that significantly lower amounts of this codon optimized plasmid are required for efficient packaging. Depending on the vector type and protocol used so far, optimal titers are achieved with 8 to 30 times less plasmid compared to non-codon optimized GALV env. We suggest to start with 0.02 µg per 1x10^6 293T packaging cells (resulting in about 0.1 µg phCMV-coGALVenv-C4070A plasmid per 10 cm cell culture dish). Full details are given in the publication.