-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGV-BM2
- Backbone size w/o insert (bp) 4842
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUpstream region of human OCT4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5068
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
- 3′ sequencing primer LucNRev (CCTTATGCAGTTGCTCTCC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phOCT4-Luc was a gift from Shinya Yamanaka (Addgene plasmid # 17221 ; http://n2t.net/addgene:17221 ; RRID:Addgene_17221) -
For your References section:
Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Cell. 2007 Nov 30. 131(5):861-72. 10.1016/j.cell.2007.11.019 PubMed 18035408