-
PurposeP1 integration cassette for AT110 Polymerase for integration onto Orthorep for Nanobody evolution with different restriction sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 2244
- Total vector size (bp) 2394
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep10B2-AT110
-
SpeciesSynthetic
- Promoter 10B2 (P1 specific promoter)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gttggccgattcattaatgcag
- 3′ sequencing primer AACCTCTGACACATGCAGCTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW212 was a gift from Chang Liu (Addgene plasmid # 172196 ; http://n2t.net/addgene:172196 ; RRID:Addgene_172196) -
For your References section:
Rapid generation of potent antibodies by autonomous hypermutation in yeast. Wellner A, McMahon C, Gilman MSA, Clements JR, Clark S, Nguyen KM, Ho MH, Hu VJ, Shin JE, Feldman J, Hauser BM, Caradonna TM, Wingler LM, Schmidt AG, Marks DS, Abraham J, Kruse AC, Liu CC. Nat Chem Biol. 2021 Jun 24. pii: 10.1038/s41589-021-00832-4. doi: 10.1038/s41589-021-00832-4. 10.1038/s41589-021-00832-4 PubMed 34168368