pEA03
(Plasmid #172194)

• Purpose: Suicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.
• Depositing Lab: Jean-Luc Pernodet
• Publication: Santos et al Microorganisms. 2022 Apr 16;10(4). pii: microorganisms10040828. doi: 10.3390/microorganisms10040828.

Backbone

• Vector backbone: pOSV805
• Backbone manufacturer: Aubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp
• Backbone size w/o insert (bp): 5835
• Total vector size (bp): 3104
• Modifications to backbone: No integrase and no amilCP modules
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: attR
• Alt name: Right attachment site of pSAM2 (minimal attR site as defined in Raynal et al. 1998)
• Species: Synthetic
• Insert Size (bp): 286

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: ATTTCAGTGCAATTTATCTCTTC

Resource Information

• Supplemental Documents:
  • pEA03.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry