pNH605-CCAAT-YFP
(Plasmid
#172132)
-
PurposeFluorescent reporter for HAP complex activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNH605
-
Vector typeYeast Expression ; vector for genomic integration into the yeast genome
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name4xCCAAT-YFP
-
SpeciesSynthetic
- Promoter CYC1 core promotor with 4 tandem repeats of the HAP complex binding motif (CCAAT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PspOMI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCAAGCATTTAGTAATGACTATCAAACC
- 3′ sequencing primer GTATATAATTTAGCTATTTGCTTAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNH605-CCAAT-YFP was a gift from Johannes Herrmann (Addgene plasmid # 172132 ; http://n2t.net/addgene:172132 ; RRID:Addgene_172132) -
For your References section:
Mitochondrial protein-induced stress triggers a global adaptive transcriptional programme. Boos F, Kramer L, Groh C, Jung F, Haberkant P, Stein F, Wollweber F, Gackstatter A, Zoller E, van der Laan M, Savitski MM, Benes V, Herrmann JM. Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18. 10.1038/s41556-019-0294-5 PubMed 30886345