pRabies-EGFP-rtTAn
(Plasmid
#172119)
-
PurposeExpression of EGFP and rtTA-InteinN in Rabies virus infected cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSADdeltaG-F3
-
Backbone manufacturerAddgene(#32634)
- Backbone size w/o insert (bp) 15034
-
Vector typeRabies Virus
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP, rtTAn-InteinN
-
SpeciesSynthetic
-
Insert Size (bp)1690
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ccgctgcatttcatcaaagtc
- 3′ sequencing primer aggttgagaagtgttgccag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEGFP from pWPI-EGFP-Puro, rtTAN from pLVX-TetOne-Puro(Clontech), InteinN from pLKO-GFP-IntN-ddFKBP (An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function. Deng Pan, et al. Sci Rep, 2016. 6: p. 26167.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Used Infusion cloning. 5' cloning site: SbfI (not destroyed), 3' cloning site: AscI (not destroyed). Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438407v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRabies-EGFP-rtTAn was a gift from Chun Xu (Addgene plasmid # 172119 ; http://n2t.net/addgene:172119 ; RRID:Addgene_172119) -
For your References section:
An intein-split transactivator for intersectional neural imaging and optogenetic manipulation. Chen HS, Zhang XL, Yang RR, Wang GL, Zhu XY, Xu YF, Wang DY, Zhang N, Qiu S, Zhan LJ, Shen ZM, Xu XH, Long G, Xu C. Nat Commun. 2022 Jun 23;13(1):3605. doi: 10.1038/s41467-022-31255-x. 10.1038/s41467-022-31255-x PubMed 35739125