Skip to main content
Addgene

PB-TO-hNGN2
(Plasmid #172115)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172115 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUCM
  • Backbone size w/o insert (bp) 13245
  • Total vector size (bp) 14092
  • Modifications to backbone
    CAG-rtTA3G-polyA
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    hNGN2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    819
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter TRE3G

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer ccgtaccacttcctaccctc
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    puroR-T2A-mycNLS-mTagBFP2
  • Insert Size (bp)
    1473
  • Promoter EF1a
  • Tag / Fusion Protein
    • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has been found to run as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TO-hNGN2 was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 172115 ; http://n2t.net/addgene:172115 ; RRID:Addgene_172115)

  • For your References section:

    A reference human induced pluripotent stem cell line for large-scale collaborative studies. Pantazis CB, Yang A, Lara E, McDonough JA, Blauwendraat C, Peng L, Oguro H, Kanaujiya J, Zou J, Sebesta D, Pratt G, Cross E, Blockwick J, Buxton P, Kinner-Bibeau L, Medura C, Tompkins C, Hughes S, Santiana M, Faghri F, Nalls MA, Vitale D, Ballard S, Qi YA, Ramos DM, Anderson KM, Stadler J, Narayan P, Papademetriou J, Reilly L, Nelson MP, Aggarwal S, Rosen LU, Kirwan P, Pisupati V, Coon SL, Scholz SW, Priebe T, Ottl M, Dong J, Meijer M, Janssen LJM, Lourenco VS, van der Kant R, Crusius D, Paquet D, Raulin AC, Bu G, Held A, Wainger BJ, Gabriele RMC, Casey JM, Wray S, Abu-Bonsrah D, Parish CL, Beccari MS, Cleveland DW, Li E, Rose IVL, Kampmann M, Calatayud Aristoy C, Verstreken P, Heinrich L, Chen MY, Schule B, Dou D, Holzbaur ELF, Zanellati MC, Basundra R, Deshmukh M, Cohen S, Khanna R, Raman M, Nevin ZS, Matia M, Van Lent J, Timmerman V, Conklin BR, Johnson Chase K, Zhang K, Funes S, Bosco DA, Erlebach L, Welzer M, Kronenberg-Versteeg D, Lyu G, Arenas E, Coccia E, Sarrafha L, Ahfeldt T, Marioni JC, Skarnes WC, Cookson MR, Ward ME, Merkle FT. Cell Stem Cell. 2022 Dec 1;29(12):1685-1702.e22. doi: 10.1016/j.stem.2022.11.004. 10.1016/j.stem.2022.11.004 PubMed 36459969
Related items:
Commonly requested with: