pGL3-Promoter-mPE(-)-Luc
(Plasmid
#172006)
-
PurposeLuciferase Reporter for Mouse PTEN Enhancer PE - Reverse Orientation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3-Promoter
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 9085
-
Vector typeMammalian Expression, Bacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse PE sequence (mPE)
-
Alt nameMouse PTEN Enhancer sequence (mPE)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4075
- Promoter SV40 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer agtactaacatacgctctcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Promoter-mPE(-)-Luc was a gift from Daniel Herranz (Addgene plasmid # 172006 ; http://n2t.net/addgene:172006 ; RRID:Addgene_172006) -
For your References section:
A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia. Tottone L, Lancho O, Loh JW, Singh A, Kimura S, Roels J, Kuchmiy A, Strubbe S, Lawlor MA, da Silva-Diz V, Luo S, Gachet S, Garcia-Prieto CA, Hagelaar R, Esteller M, Meijerink JPP, Soulier J, Taghon T, Van Vlierberghe P, Mullighan CG, Khiabanian H, Rocha PP, Herranz D. Blood Cancer Discov. 2021 Jan;2(1):92-109. doi: 10.1158/2643-3230.BCD-20-0201. Epub 2020 Nov 24. 10.1158/2643-3230.BCD-20-0201 PubMed 33458694