pGEX2T-TUBG1
(Plasmid #171967)

• Purpose: pGEX2T-TUBG1 bacterial expression plasmid for production of recombinant GST fusion protein
• Depositing Lab: Maria Alvarado-Kristensson
• Publication: Corvaisier et al Commun Biol. 2021 Jun 22;4(1):767. doi: 10.1038/s42003-021-02280-1.

Backbone

• Vector backbone: pGEX2t
• Backbone manufacturer: AMRAD corparation limited
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 6247
• Modifications to backbone: SmaI site deleted
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: induction with 0.22 mM IPTG for 1 h at 37 °ºC followed by overnight incubation at room temperature.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TUBG1
• Species: H. sapiens (human)
• Insert Size (bp): 1347
• Mutation: R275H (Please see depositor comments)
• Entrez Gene: TUBG1 (a.k.a. CDCBM4, GCP-1, TUBG, TUBGCP1)
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCAAAATCGGATCTGGTTCC
• 3′ sequencing primer: CAGATCGTCAGTCAGTCACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: TUBG1 was a gift from Jiri Bartek (Institute of Cancer Biology, Danish Cancer Society).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The TUBG1 gene from the plasmid obtained from Jiri Bartek was subcloned into pGEX2t. Addgene NGS found mutation R275H [NP_001061.2 ] but the depositor confirmed that this mutation does not affect function