AAVS1-Puro CAG-CLTX CD32a ITAM CD3z CAR
(Plasmid
#171965)
-
PurposeDonor plasmid for CLTX CD32a-ITAM CD3z CAR expression in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAddgene Plasmid #136934
- Backbone size w/o insert (bp) 10225
- Total vector size (bp) 11744
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic CLTX CD32a ITAM CD3z CAR
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1519
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc
- 3′ sequencing primer none (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG-CLTX CD32a ITAM CD3z CAR was a gift from Xiaoping Bao (Addgene plasmid # 171965 ; http://n2t.net/addgene:171965 ; RRID:Addgene_171965) -
For your References section:
CAR-neutrophil mediated delivery of tumor-microenvironment responsive nanodrugs for glioblastoma chemo-immunotherapy. Chang Y, Cai X, Syahirah R, Yao Y, Xu Y, Jin G, Bhute VJ, Torregrosa-Allen S, Elzey BD, Won YY, Deng Q, Lian XL, Wang X, Eniola-Adefeso O, Bao X. Nat Commun. 2023 Apr 20;14(1):2266. doi: 10.1038/s41467-023-37872-4. 10.1038/s41467-023-37872-4 PubMed 37080958