Skip to main content
Addgene

AAVS1-Puro CAG J591-scFV T-CAR
(Plasmid #171961)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171961 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Addgene Plasmid #136934
  • Backbone size w/o insert (bp) 10225
  • Total vector size (bp) 12122
  • Vector type
    Mammalian Expression, CRISPR, TALEN, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic J591-scFV CAR
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1897
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer gctaaccatgttcatgccttc
  • 3′ sequencing primer none
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Puro CAG J591-scFV T-CAR was a gift from Xiaoping Bao (Addgene plasmid # 171961 ; http://n2t.net/addgene:171961 ; RRID:Addgene_171961)

  • For your References section:

    Engineered anti-prostate cancer CAR-neutrophils from human pluripotent stem cells. Harris JD, Chang Y, Syahirah R, Lian XL, Deng Q, Bao X. J Immunol Regen Med. 2023 May;20:100074. doi: 10.1016/j.regen.2023.100074. Epub 2023 Apr 1. 10.1016/j.regen.2023.100074 PubMed 37089616
Related items:
Commonly requested with: