pAAV-CAG-Flex-mGFP-APEX2
(Plasmid
#171936)
-
PurposeReporter for correlated light and electron microscopy.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemGFP-APEX2
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KPNI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-Flex-mGFP-APEX2 was a gift from David Berson (Addgene plasmid # 171936 ; http://n2t.net/addgene:171936 ; RRID:Addgene_171936) -
For your References section:
Local axonal morphology guides the topography of interneuron myelination in mouse and human neocortex. Stedehouder J, Brizee D, Slotman JA, Pascual-Garcia M, Leyrer ML, Bouwen BL, Dirven CM, Gao Z, Berson DM, Houtsmuller AB, Kushner SA. Elife. 2019 Nov 19;8. pii: 48615. doi: 10.7554/eLife.48615. 10.7554/eLife.48615 PubMed 31742557