pAAV-CAG-Flex-mGFP-APEX2
(Plasmid #171936)

• Purpose: Reporter for correlated light and electron microscopy.
• Depositing Lab: David Berson
• Publication: Stedehouder et al Elife. 2019 Nov 19;8. pii: 48615. doi: 10.7554/eLife.48615.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mGFP-APEX2
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: KPNI (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry