-
PurposeExpress DogCatcher-superfolder GFP protein in bacterial cytoplasm
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ404
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5122
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDogCatcher-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1122
- Promoter T5
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer lacOT5 (Gcgctcacaattccacaacggtttccc)
- 3′ sequencing primer Term2 (CGAAAGGCTCAGTCGAAAGAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJ404-DogCatcher-sfGFP was a gift from Mark Howarth (Addgene plasmid # 171930 ; http://n2t.net/addgene:171930 ; RRID:Addgene_171930) -
For your References section:
DogCatcher allows loop-friendly protein-protein ligation. Keeble AH, Yadav VK, Ferla MP, Bauer CC, Chuntharpursat-Bon E, Huang J, Bon RS, Howarth M. Cell Chem Biol. 2021 Jul 28. pii: S2451-9456(21)00315-9. doi: 10.1016/j.chembiol.2021.07.005. 10.1016/j.chembiol.2021.07.005 PubMed 34324879