miR7 MmATP10B
(Plasmid
#171825)
-
Purposetransfer plasmid for lentiviral vector production with miR for Mm ATP10B
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneSIV tranfserplasmide
-
Backbone manufacturerDidier Nègre
- Backbone size w/o insert (bp) 7445
- Total vector size (bp) 7514
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP10B
-
gRNA/shRNA sequencecctaagacagtgcctatacat
-
SpeciesM. musculus (mouse)
-
Entrez GeneAtp10b (a.k.a. 5930426O13Rik, 9030605H24Rik)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer TCATTTTACTGGGGGACCTTGTGCA
- 3′ sequencing primer caacgggccacaactcctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR7 MmATP10B was a gift from Veerle Baekelandt (Addgene plasmid # 171825 ; http://n2t.net/addgene:171825 ; RRID:Addgene_171825) -
For your References section:
Mutated ATP10B increases Parkinson's disease risk by compromising lysosomal glucosylceramide export. Martin S, Smolders S, Van den Haute C, Heeman B, van Veen S, Crosiers D, Beletchi I, Verstraeten A, Gossye H, Gelders G, Pals P, Hamouda NN, Engelborghs S, Martin JJ, Eggermont J, De Deyn PP, Cras P, Baekelandt V, Vangheluwe P, Van Broeckhoven C. Acta Neuropathol. 2020 Jun;139(6):1001-1024. doi: 10.1007/s00401-020-02145-7. Epub 2020 Mar 14. 10.1007/s00401-020-02145-7 PubMed 32172343