Skip to main content
Addgene

pCRISPaint-mScarlet-F-hgp100-BlastR [M1G]
(Plasmid #171815)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171815 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCRISPaint
  • Backbone manufacturer
    Based on plasmids published by Schmid-Burgk et al. 2016 (DOI: 10.1038/ncomms12338)
  • Backbone size w/o insert (bp) 2577
  • Total vector size (bp) 3846
  • Vector type
    Gene tagging
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mScarlet-F-hgp100-T2A-BlastR
  • Species
    H. sapiens (human), Synthetic; Discosoma sp., Bacillus cereus
  • Insert Size (bp)
    1269
  • Mutation
    BlastR: Changed Methionin 1 to Glycine.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGATAGTACTAACATACGCTCTCCA
  • 3′ sequencing primer CTCCCCCTGAACCTGAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPaint-mScarlet-F-hgp100-BlastR [M1G] was a gift from Michael Hoelzel (Addgene plasmid # 171815 ; http://n2t.net/addgene:171815 ; RRID:Addgene_171815)
  • For your References section:

    Adoptive T Cell Therapy Targeting Different Gene Products Reveals Diverse and Context-Dependent Immune Evasion in Melanoma. Effern M, Glodde N, Braun M, Liebing J, Boll HN, Yong M, Bawden E, Hinze D, van den Boorn-Konijnenberg D, Daoud M, Aymans P, Landsberg J, Smyth MJ, Flatz L, Tuting T, Bald T, Gebhardt T, Holzel M. Immunity. 2020 Sep 15;53(3):564-580.e9. doi: 10.1016/j.immuni.2020.07.007. Epub 2020 Aug 3. 10.1016/j.immuni.2020.07.007 PubMed 32750334