pUCSh5-2300
(Plasmid
#171788)
-
PurposeEncodes sgRNA target 2300 and Gentamicin resistance transposon.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 5219
- Total vector size (bp) 5243
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSh-CAST sgRNA 2300
-
gRNA/shRNA sequenceggggtagcgggcgaagcactgcag
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggggttccgcgcacatttc
- 3′ sequencing primer caacgctgatgggtcacgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid #127924 - pDonor_ShCAST_kanR
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCSh5-2300 was a gift from Christopher Reisch (Addgene plasmid # 171788 ; http://n2t.net/addgene:171788 ; RRID:Addgene_171788) -
For your References section:
CRISPR-Associated Transposase for Targeted Mutagenesis in Diverse Proteobacteria. Trujillo Rodriguez L, Ellington AJ, Reisch CR, Chevrette MG. ACS Synth Biol. 2023 Jun 27. doi: 10.1021/acssynbio.3c00065. 10.1021/acssynbio.3c00065 PubMed 37368499