Skip to main content
Addgene

miR3 Mm ATP13A2
(Plasmid #171771)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171771 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    SIV tranfserplasmide
  • Backbone manufacturer
    Didier Nègre
  • Backbone size w/o insert (bp) 7445
  • Total vector size (bp) 7514
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATP13A2
  • gRNA/shRNA sequence
    cacgccgaaacactcgttata
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Atp13a2 (a.k.a. 1110012E06Rik, AA589443)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer TCATTTTACTGGGGGACCTTGTGCA
  • 3′ sequencing primer caacgggccacaactcctc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR3 Mm ATP13A2 was a gift from Veerle Baekelandt (Addgene plasmid # 171771 ; http://n2t.net/addgene:171771 ; RRID:Addgene_171771)

  • For your References section:

    ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848
Related items:
Commonly requested with: