Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRN3P_T3_ABEmax_IVT
(Plasmid #171761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171761 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRN3P
  • Backbone manufacturer
    Torres-Padilla et al., 2007
  • Backbone size w/o insert (bp) 3228
  • Total vector size (bp) 8640
  • Modifications to backbone
    Between the 5'UTR and the 3'UTR we added the ABEmax (Adenine Base Editor #112095)
  • Vector type
    Vector for in-vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Incubate solid or liquid cultures always at 30°C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ABEmax
  • Alt name
    Adenine Base Editor
  • Species
    Synthetic
  • Insert Size (bp)
    5412
  • Promoter T3 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer ATCCGCGGCCGCTCACCTACTTAGACTTTCCTCTTCTTCTTGGGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pCMV_ABEmax was a gift from David Liu (Addgene plasmid #112095; http://n2t.net/addgene:112095 ; RRID:Addgene_112095). The in-vitro transcription backbone was published by Torres-Padilla et al., 2007.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRN3P_T3_ABEmax_IVT was a gift from Timo Otonkoski (Addgene plasmid # 171761 ; http://n2t.net/addgene:171761 ; RRID:Addgene_171761)
  • For your References section:

    Simultaneous high-efficiency base editing and reprogramming of patient fibroblasts. Jalil S, Keskinen T, Maldonado R, Sokka J, Trokovic R, Otonkoski T, Wartiovaara K. Stem Cell Reports. 2021 Nov 16. pii: S2213-6711(21)00552-X. doi: 10.1016/j.stemcr.2021.10.017. 10.1016/j.stemcr.2021.10.017 PubMed 34822772