-
PurposeGPI-anchored RpHLuorin2 for plasma membrane expression (extracellular)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRpHluorin-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4730
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRatiometric pHLuorin2 fused to GPI anchor
-
Alt nameglycosylphosphatidylinositol-pHluorin2
-
SpeciesH. sapiens (human)
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- ratiometric pHluorin2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GPI-RpHLuorin2 was generated by replacing mRFP from GPI-mRFP with synthetic RpHLuorin2 with restriction sites XmaI and NotI.
Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GPI-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171721 ; http://n2t.net/addgene:171721 ; RRID:Addgene_171721) -
For your References section:
Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377