Skip to main content
Addgene

LAMP1-RpHLuorin2
(Plasmid #171720)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171720 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRpHluorin-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4730
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ratiometric pHLuorin2 fused to LAMP1
  • Alt name
    CD107a, LAMPA, LGP120
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_005561.3
  • Entrez Gene
    LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
  • Promoter CMV
  • Tag / Fusion Protein
    • ratiometric pHluorin2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    LAMP1 was cloned from Addgene plasmid #34831

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Targeting to LAMP1-positive compartments was achieved by inserting the signal sequence of LAMP1 (LAMP1-mGFP74, Addgene plasmid #34831) N-terminal to RpHLuorin2 with restriction sites HindIII and AgeI. Then, the luminal domain of LAMP1 was placed C-terminal to RpHLuorin2 after a flexible GSGS linker with restriction sites BsrGI and NotI.

Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LAMP1-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171720 ; http://n2t.net/addgene:171720 ; RRID:Addgene_171720)
  • For your References section:

    Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377