-
PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRpHluorin-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4730
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRatiometric pHLuorin2 fused to MGAT2
-
Alt nameAlpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase
-
SpeciesH. sapiens (human)
-
GenBank IDNM_002408.3
- Promoter CMV
-
Tag
/ Fusion Protein
- ratiometric pHluorin2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043
Targeting to the MGAT2-positive compartment was achieved by inserting synthetic truncated MGAT2 (residues 1-89 of Uniprot Q10469, Genscript)
The starting codon of RpHLuorin2 was removed and a flexible GGSGGS linker was added between the two protein fragments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MGAT2-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171718 ; http://n2t.net/addgene:171718 ; RRID:Addgene_171718) -
For your References section:
Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377