Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

QUAS-0-T7-GFP_ColE1
(Plasmid #171649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Amp-ColE1 – GFPssrA-T7stop
  • Backbone size w/o insert (bp) 2757
  • Total vector size (bp) 2856
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QUAS-0-T7
  • Insert Size (bp)
    99
  • Promoter T7
  • Tag / Fusion Protein
    • ssrA degradation tag (DAS+4) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer GAATAGTGTATGCGGCGACC
  • 3′ sequencing primer CTGCACGCCGTAGGTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    QUAS-0-T7-GFP_ColE1 was a gift from Tara Deans (Addgene plasmid # 171649 ; http://n2t.net/addgene:171649 ; RRID:Addgene_171649)
  • For your References section:

    Enhanced regulation of prokaryotic gene expression by a eukaryotic transcriptional activator. MacDonald IC, Seamons TR, Emmons JC, Javdan SB, Deans TL. Nat Commun. 2021 Jul 5;12(1):4109. doi: 10.1038/s41467-021-24434-9. 10.1038/s41467-021-24434-9 PubMed 34226549