pJRH056
(Plasmid #171637)

• Purpose: Plasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2
• Depositing Lab: Jennifer Doudna
• Publication: Hamilton et al Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207.

Backbone

• Vector backbone: Custom
• Backbone size w/o insert (bp): 4230
• Total vector size (bp): 4943
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: spyCas9 sgRNA-tdTomato
• Insert Size (bp): 20
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GCTGTTAGAGAGATAATTGG
• 3′ sequencing primer: TATTGGCGTTACTATTGACG

Gene/Insert 2

• Gene/Insert name: mTagBFP2
• Insert Size (bp): 689
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TAATTACCTGGAGCACCTGC
• 3′ sequencing primer: CTCATTTTATTAGGAAAGGACAGTGG

Resource Information

• Supplemental Documents:
  • pJRH056_U6-sgRNA-tdTom-mTagBFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry