Skip to main content
Addgene

pCAT005
(Plasmid #171632)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171632 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCF221
  • Backbone size w/o insert (bp) 9105
  • Total vector size (bp) 9835
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Bleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    spyCas9 sgRNA-B2M
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gatacaaggctgttagagag
  • 3′ sequencing primer catcactttcccagtttacc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mNeon
  • Insert Size (bp)
    711
  • Promoter EF1-a

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttaggccagcttggcacttg
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAT005 was a gift from Jennifer Doudna (Addgene plasmid # 171632 ; http://n2t.net/addgene:171632 ; RRID:Addgene_171632)
  • For your References section:

    Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Hamilton JR, Tsuchida CA, Nguyen DN, Shy BR, McGarrigle ER, Sandoval Espinoza CR, Carr D, Blaeschke F, Marson A, Doudna JA. Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207. 10.1016/j.celrep.2021.109207 PubMed 34077734