pJRH051
(Plasmid #171625)

• Purpose: 2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA (no spacer, BsmBI cutsites) and an EF1-a promoter expressing mNeonGreen
• Depositing Lab: Jennifer Doudna
• Publication: Hamilton et al Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207.

Backbone

• Vector backbone: pCF221
• Backbone size w/o insert (bp): 9104
• Total vector size (bp): 9841
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Bleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: spyCas9 sgRNA-BsmBI-Destination
• Insert Size (bp): 26
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: gatacaaggctgttagagag
• 3′ sequencing primer: catcactttcccagtttacc

Gene/Insert 2

• Gene/Insert name: mNeon
• Insert Size (bp): 711
• Promoter: EF1-a

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttaggccagcttggcacttg
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pJRH051_LV-U6-sgRNA-DEST-EF1a-mNeon.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry