Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEMHE-bNup98-DN-NLS-mClover3
(Plasmid #171495)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171495 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEHME
  • Vector type
    pGEHME

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nup98-DN
  • Species
    B. tarus (bovine)
  • Entrez Gene
    NUP98 (a.k.a. BOS_14946)
  • Promoter T7
  • Tag / Fusion Protein
    • mClover3 (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer M13: GTAAAACGACGGCCAGT
  • 3′ sequencing primer GGCTACATTTTGGGGGACAACATTTTGTAAAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dominant negative version of bovine Nup98 (amino acids 482-524) with a nuclear localization signal (NLS) and C-terminal mClover tag.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-bNup98-DN-NLS-mClover3 was a gift from Melina Schuh (Addgene plasmid # 171495 ; http://n2t.net/addgene:171495 ; RRID:Addgene_171495)
  • For your References section:

    Parental genome unification is highly error-prone in mammalian embryos. Cavazza T, Takeda Y, Politi AZ, Aushev M, Aldag P, Baker C, Choudhary M, Bucevicius J, Lukinavicius G, Elder K, Blayney M, Lucas-Hahn A, Niemann H, Herbert M, Schuh M. Cell. 2021 Apr 30. pii: S0092-8674(21)00492-X. doi: 10.1016/j.cell.2021.04.013. 10.1016/j.cell.2021.04.013 PubMed 33964210